View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0459_high_4 (Length: 225)
Name: NF0459_high_4
Description: NF0459
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0459_high_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 1 - 157
Target Start/End: Complemental strand, 54268086 - 54267930
Alignment:
| Q |
1 |
ttttattttgtgaaagaaaaggtgtgtacagtatttcattgtttgccaagataattagagacaaagattttgaacttaccatatgttccgagataaagat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54268086 |
ttttattttgtgaaagaaaaggtgtgtacagtatttcattgtttgctaagataattagagacaaagattttgaacttaccatatgttccgagataaagat |
54267987 |
T |
 |
| Q |
101 |
acttattgccaaaaactttgccaatccgtgcctcccaccttccgttatgatgatgtc |
157 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54267986 |
acttattgccaaaaactttgccaatccgtgcctcccaccttccgttatgatgatgtc |
54267930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 73 - 157
Target Start/End: Complemental strand, 25051958 - 25051874
Alignment:
| Q |
73 |
aacttaccatatgttccgagataaagatacttattgccaaaaactttgccaatccgtgcctcccaccttccgttatgatgatgtc |
157 |
Q |
| |
|
|||| |||||||||||| ||||||||||| || ||||||||||| | || || || ||||||||||||||||||||||| |||| |
|
|
| T |
25051958 |
aactaaccatatgttccaagataaagatatttgttgccaaaaaccctaccgatacgagcctcccaccttccgttatgatggtgtc |
25051874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University