View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0459_low_2 (Length: 341)
Name: NF0459_low_2
Description: NF0459
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0459_low_2 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 103 - 341
Target Start/End: Original strand, 56174401 - 56174639
Alignment:
| Q |
103 |
agatgttatgtatggaagcacattcaaggtggaattactttatctgatcacacctggaccggagttgtcatcagaagaacaatgttcacgtctggtgata |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56174401 |
agatgttatgtatggaagcacattcaaggtggaattactttatctgatcacacctggaccggagttgtcatcagaagaacaatgttcacgtctggtgata |
56174500 |
T |
|
| Q |
203 |
tcatggagaatgaatttcttacaaagcaccatgatgaaaggaatgatagaaaatggagctcggcaaggtatgaaggaatccttcgatcagtatgccattt |
302 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56174501 |
tcatggagaatgaatttcttacaaagcaccatgatgaaaggaatgatagaaaatggagctcggcaaggtatgaaggaatccttcgatcagtatgccattt |
56174600 |
T |
|
| Q |
303 |
tgttatctcagactgctaagcctgttgactcaaaggatc |
341 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56174601 |
tgttatctcagactgctaagcctgttgactcaaaggatc |
56174639 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 79; Significance: 7e-37; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 79; E-Value: 7e-37
Query Start/End: Original strand, 149 - 279
Target Start/End: Original strand, 9995950 - 9996080
Alignment:
| Q |
149 |
atcacacctggaccggagttgtcatcagaagaacaatgttcacgtctggtgatatcatggagaatgaatttcttacaaagcaccatgatgaaaggaatga |
248 |
Q |
| |
|
||||||||||||||||||||| | |||| |||||| ||||| | |||||| ||||| ||| |||||||||| ||||| |||||||||||||||||||||| |
|
|
| T |
9995950 |
atcacacctggaccggagttgccctcaggagaacagtgttcgcatctggttatatcctggcgaatgaattttttacagagcaccatgatgaaaggaatga |
9996049 |
T |
|
| Q |
249 |
tagaaaatggagctcggcaaggtatgaagga |
279 |
Q |
| |
|
|||||||||| |||||||||||| ||||||| |
|
|
| T |
9996050 |
tagaaaatggggctcggcaaggtgtgaagga |
9996080 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 74 times since January 2019
Visitors: 3464