View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0459_low_3 (Length: 317)
Name: NF0459_low_3
Description: NF0459
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0459_low_3 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 150; Significance: 3e-79; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 150; E-Value: 3e-79
Query Start/End: Original strand, 23 - 223
Target Start/End: Original strand, 10011371 - 10011561
Alignment:
| Q |
23 |
cacagagcttggatttggacaacaatgaggggtgttcatcttttgcagaaaaaataagaaatcctcggtgatcattgaatcgatccaaaacatgtcgtaa |
122 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10011371 |
cacagagcttggatttggacaacaaagaggggtgttcatcttttgcagaaaaaataagaaatcctcggtgatcattgaatcgatccaaaacatgtcgtaa |
10011470 |
T |
|
| Q |
123 |
atttcgttgttgatgaaggttgatgaaagattctggcggagaacatgcagctatgcagatggcattgaagagttggatagatactgtgttgttgaaccaa |
222 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||| ||||||||||| |
|
|
| T |
10011471 |
atttcgtt----------gttgatgaaagattctggcggagaacatgcagctatggagatggcattgaagagttggatggatactgtgctgttgaaccaa |
10011560 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1540 times since January 2019
Visitors: 3457