View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0459_low_4 (Length: 274)
Name: NF0459_low_4
Description: NF0459
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0459_low_4 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 51 - 251
Target Start/End: Original strand, 5849846 - 5850046
Alignment:
| Q |
51 |
caaaaatttgagaactcatgcttatttttcatttcattcaaacacatatggagcaactctgacttaattatttgataatgtactcgagttatacaatgtg |
150 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5849846 |
caaaaatttgagaactcatgcttatttttcatttcatccaaacacatatggagcaactctgacttaattatttgataatgtactcgagttatacaatgtg |
5849945 |
T |
|
| Q |
151 |
ttgctttgaggcaacgacataatcacattcattaattacctatttgatctatgtcatagagattcaactgtctaacacaatcaccttcttttctctcgac |
250 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||| |
|
|
| T |
5849946 |
ttgctttcaggcaacgacataatcacattcattaattacctatttgatctatgtcatagagattcaactgtctaacacaatcaccttcttttatctagac |
5850045 |
T |
|
| Q |
251 |
t |
251 |
Q |
| |
|
| |
|
|
| T |
5850046 |
t |
5850046 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1482 times since January 2019
Visitors: 3452