View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0459_low_7 (Length: 248)
Name: NF0459_low_7
Description: NF0459
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0459_low_7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 76; Significance: 3e-35; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 152 - 239
Target Start/End: Original strand, 10564977 - 10565063
Alignment:
Q |
152 |
tttgagcagatttttatcattaagaatgtgtatcatcaagaataagctcttctcttttttaaagcatacattcaaatcgactttgggt |
239 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||| |
|
|
T |
10564977 |
tttgagcagatttttatcattaagaatgtgtatcatcaagaataagctcttctcttttttaaagcatacattc-aattgactttgggt |
10565063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 29 - 104
Target Start/End: Original strand, 10564785 - 10564862
Alignment:
Q |
29 |
aaattatgacaaa--tattttgaccggcaatgcctggtgtcagcttctgacagtactgccacatgaaatagcggtatt |
104 |
Q |
|
|
||||||||||||| |||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
10564785 |
aaattatgacaaaaatattttgaccggcaatgcctcgtgtcagcttctgacagtaccgccacatgaaatagcggtatt |
10564862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 39 times since January 2019
Visitors: 3463