View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0460_high_3 (Length: 263)
Name: NF0460_high_3
Description: NF0460
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0460_high_3 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 165; Significance: 2e-88; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 1 - 165
Target Start/End: Complemental strand, 38180563 - 38180399
Alignment:
| Q |
1 |
ttcgccaccttctctgacggccacgacgatggcccaaaattcgaaagcaacgaagactttgtcacctacgagtatgagcttaagcgccgctgctcggaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38180563 |
ttcgccaccttctctgacggccacgacgatggcccaaaattcgaaagcaacgaagactttgtcacctacgagtatgagcttaagcgccgctgctcggaat |
38180464 |
T |
|
| Q |
101 |
ttctcacaaatatcatactctccggcaaacaggaaggtcgtccattcacttgcttagcctacggt |
165 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38180463 |
ttctcacaaatatcatactctccggcaaacaggaaggtcgtccattcacttgcttagcctacggt |
38180399 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 1 - 165
Target Start/End: Complemental strand, 38185232 - 38185068
Alignment:
| Q |
1 |
ttcgccaccttctctgacggccacgacgatggcccaaaattcgaaagcaacgaagactttgtcacctacgagtatgagcttaagcgccgctgctcggaat |
100 |
Q |
| |
|
||||||||||||||||| ||| ||||||| || ||| |||||||||||||||||||| || ||||| || ||||||||| ||| |||||| |||| |
|
|
| T |
38185232 |
ttcgccaccttctctgatggctacgacgacggtaaaaatttcgaaagcaacgaagacttcatcgcctacaggtccgagcttaagtgccactgctcagaat |
38185133 |
T |
|
| Q |
101 |
ttctcacaaatatcatactctccggcaaacaggaaggtcgtccattcacttgcttagcctacggt |
165 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38185132 |
ttctaacaaatatcatactctccggcaaacaggaaggtcgtccattcacttgcttagcctacggt |
38185068 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 1 - 156
Target Start/End: Complemental strand, 38170749 - 38170594
Alignment:
| Q |
1 |
ttcgccaccttctctgacggccacgacgatggcccaaaattcgaaagcaacgaagactttgtcacctacgagtatgagcttaagcgccgctgctcggaat |
100 |
Q |
| |
|
||||||||||||||||||||| | ||||| || | ||||| | || |||||||| | ||| ||||| || |||| ||| ||| ||| |||| |||| |
|
|
| T |
38170749 |
ttcgccaccttctctgacggctatgacgacggtcaaaaatcctttggcgacgaagacatcgtctcctacatgtctgagtttacgcgtcgcggctcagaat |
38170650 |
T |
|
| Q |
101 |
ttctcacaaatatcatactctccggcaaacaggaaggtcgtccattcacttgctta |
156 |
Q |
| |
|
|||||||||||||||| |||||| |||||| ||| || |||||||||||||||| |
|
|
| T |
38170649 |
ttctcacaaatatcattctctcctccaaacaagaaaatcatccattcacttgctta |
38170594 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1279 times since January 2019
Visitors: 3440