View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0462_low_11 (Length: 333)
Name: NF0462_low_11
Description: NF0462
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0462_low_11 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 147; Significance: 2e-77; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 147; E-Value: 2e-77
Query Start/End: Original strand, 104 - 254
Target Start/End: Original strand, 1887688 - 1887838
Alignment:
Q |
104 |
gggtaaacaaatttttggcgtgatcgttcctcttctctttatcttgttctttggttatgattatgaattagctatacatctagctagtttgctatattta |
203 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
T |
1887688 |
gggtaaacaaatttttggcgtgatcgttcctcttctctttatcttgttctttggttatgattatgaattagctatacatctagctaggttgctatattta |
1887787 |
T |
 |
Q |
204 |
ctaatattgattatttttgcttggactgttttaatttgttggttgcctttg |
254 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
1887788 |
ctaatattgattatttttgcttggactgttttaatttgttggttgcctttg |
1887838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University