View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0462_low_11 (Length: 333)

Name: NF0462_low_11
Description: NF0462
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0462_low_11
NF0462_low_11
[»] chr6 (1 HSPs)
chr6 (104-254)||(1887688-1887838)


Alignment Details
Target: chr6 (Bit Score: 147; Significance: 2e-77; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 147; E-Value: 2e-77
Query Start/End: Original strand, 104 - 254
Target Start/End: Original strand, 1887688 - 1887838
Alignment:
Q  104 gggtaaacaaatttttggcgtgatcgttcctcttctctttatcttgttctttggttatgattatgaattagctatacatctagctagtttgctatattta 203  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
T  1887688 gggtaaacaaatttttggcgtgatcgttcctcttctctttatcttgttctttggttatgattatgaattagctatacatctagctaggttgctatattta 1887787  T
Q  204 ctaatattgattatttttgcttggactgttttaatttgttggttgcctttg 254  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||    
T  1887788 ctaatattgattatttttgcttggactgttttaatttgttggttgcctttg 1887838  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University