View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0462_low_13 (Length: 311)
Name: NF0462_low_13
Description: NF0462
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0462_low_13 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 30 - 287
Target Start/End: Original strand, 44731527 - 44731784
Alignment:
| Q |
30 |
ggtaagaggtttttgattgctggtggtggagcgccccagattgagttgtcgaggcagttgggtgtttgggcaaaggtgctgcatgggatggaaagttcct |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||| |
|
|
| T |
44731527 |
ggtaagaggtttttgattgctggtggtggagcgcccgagattgagttgtcgaggcagttgggtgcttgggcaaaggtgctgcatgggatggaaggttcct |
44731626 |
T |
 |
| Q |
130 |
gcattcaagcatttgctgaggcacttgaagtcattccgtatactttggccgagaatgctggtttgaatccgattgcgattgttactgagctgaggaatcg |
229 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44731627 |
gcattcaagcatttgctgaggcactcgaagtcattccgtatactttggccgagaatgctggtttgaatccgattgcgattgttactgagctgaggaatcg |
44731726 |
T |
 |
| Q |
230 |
tcatgcacagggtgagataaatgctggaatcaatgtgaggaaaggtcaaattacaaac |
287 |
Q |
| |
|
||||||||| ||||||||||||||||||||| ||||||||||||||||| |||||||| |
|
|
| T |
44731727 |
tcatgcacaaggtgagataaatgctggaatcgatgtgaggaaaggtcaatttacaaac |
44731784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 114; Significance: 8e-58; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 114; E-Value: 8e-58
Query Start/End: Original strand, 33 - 290
Target Start/End: Original strand, 50702069 - 50702326
Alignment:
| Q |
33 |
aagaggtttttgattgctggtggtggagcgccccagattgagttgtcgaggcagttgggtgtttgggcaaaggtgctgcatgggatggaaagttcctgca |
132 |
Q |
| |
|
||||||||||||||||| |||||||| || || |||| ||| |||||||||| ||||||| |||||| ||||| ||||||| ||||| ||| ||| | |
|
|
| T |
50702069 |
aagaggtttttgattgcaggtggtggtgctccggagatagagctgtcgaggcaattgggtgcttgggctaaggttttgcatggcatggagggttactgta |
50702168 |
T |
 |
| Q |
133 |
ttcaagcatttgctgaggcacttgaagtcattccgtatactttggccgagaatgctggtttgaatccgattgcgattgttactgagctgaggaatcgtca |
232 |
Q |
| |
|
||| ||||||||||||||||||||||| |||| ||||| | || |||||||| |||||||| |||||||| |||||||||||||| ||||||||||| |
|
|
| T |
50702169 |
ttcgtgcatttgctgaggcacttgaagttgttccatatacacttgctgagaatgcgggtttgaacccgattgcaattgttactgagctaaggaatcgtca |
50702268 |
T |
 |
| Q |
233 |
tgcacagggtgagataaatgctggaatcaatgtgaggaaaggtcaaattacaaacatc |
290 |
Q |
| |
|
||| | |||||||| ||| ||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
50702269 |
tgctaaaggtgagatcaatactggaatcaatgtcaggaaaggtcaaattacaaacatc |
50702326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University