View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0462_low_16 (Length: 267)
Name: NF0462_low_16
Description: NF0462
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0462_low_16 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 87; Significance: 9e-42; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 87; E-Value: 9e-42
Query Start/End: Original strand, 145 - 267
Target Start/End: Original strand, 11725761 - 11725883
Alignment:
| Q |
145 |
ttgaataaattctcccaaactctctcacaagagcttattattagtggtttgtgtaacctgttatttgtcatttcttgtactagattgataatcttatctc |
244 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| ||||||||||||||||||| || ||||||||||||||||||||||||||| ||| | ||||| |
|
|
| T |
11725761 |
ttgaataagttctcccaaactctctcacaagagcttaatattagtggtttgtgtaacatggtatttgtcatttcttgtactagattgagaatatcatctc |
11725860 |
T |
|
| Q |
245 |
ttataacctgtaactatttcttt |
267 |
Q |
| |
|
||||||| ||||| ||||||||| |
|
|
| T |
11725861 |
ttataacttgtaaatatttcttt |
11725883 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 60; Significance: 1e-25; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 7 - 78
Target Start/End: Complemental strand, 42636094 - 42636023
Alignment:
| Q |
7 |
attacttgcatagcattgtatcacatgcatcgccaatgcactgatttacttcaatttttcccctatgatact |
78 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
42636094 |
attacttgcatagcatcgtatcacatgcatcaccaatgcactgatttacttcaatttttcccctatgttact |
42636023 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 12 - 53
Target Start/End: Complemental strand, 49601203 - 49601162
Alignment:
| Q |
12 |
ttgcatagcattgtatcacatgcatcgccaatgcactgattt |
53 |
Q |
| |
|
||||||||||||| ||||||| |||| ||||||||||||||| |
|
|
| T |
49601203 |
ttgcatagcattgaatcacatacatcaccaatgcactgattt |
49601162 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 365 times since January 2019
Visitors: 3472