View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0462_low_18 (Length: 247)
Name: NF0462_low_18
Description: NF0462
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0462_low_18 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 35 - 190
Target Start/End: Original strand, 6485626 - 6485781
Alignment:
Q |
35 |
gaacctgtgctgtcaattgctaaagcagttactgcacattcttgttttaaaagttgtttaaccattacatgttttgttgctttaccacgtggttctcttc |
134 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
6485626 |
gaacctgtgctgtcaattgctaaagcagttactgcacattcttgttttaaaagttgtttaaccattacatgttttgttgctttaccacgtggttctcttc |
6485725 |
T |
 |
Q |
135 |
gccacactttaactgttccgtctgctgaaccagagaaaacaattccgtcgtttcca |
190 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
6485726 |
gccacactttaactgttccgtctgctgaaccagagaaaacaattccgtcgtttcca |
6485781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University