View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0462_low_19 (Length: 228)
Name: NF0462_low_19
Description: NF0462
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0462_low_19 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 91; Significance: 3e-44; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 1 - 104
Target Start/End: Complemental strand, 10219350 - 10219245
Alignment:
Q |
1 |
ctgattctaaacgttctatgcttctgttgcttcctagacttaattctcgtacttctctccatagttcttctatcttctcattcattct--cagatactat |
98 |
Q |
|
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
T |
10219350 |
ctgattctaaacgttctatgcttcttttgcttcctagacttaattctcgtacttctctccatagttcttctatcttctcattcattctcacagatactat |
10219251 |
T |
 |
Q |
99 |
gttatt |
104 |
Q |
|
|
|||||| |
|
|
T |
10219250 |
gttatt |
10219245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 3 - 87
Target Start/End: Original strand, 13853943 - 13854027
Alignment:
Q |
3 |
gattctaaacgttctatgcttctgttgcttcctagacttaattctcgtacttctctccatagttcttctatcttctcattcattc |
87 |
Q |
|
|
|||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
13853943 |
gattctaaacgttctatggttctgttgcttcctaaacttaattctcgtacttctctccatagttcttctatcttctcattcattc |
13854027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University