View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0462_low_8 (Length: 345)
Name: NF0462_low_8
Description: NF0462
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0462_low_8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 125; Significance: 2e-64; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 196 - 320
Target Start/End: Complemental strand, 35163754 - 35163630
Alignment:
Q |
196 |
ttaaaatatggaaaggaatgtttgaaggttttgtgaagagacaacctttttggatgtagtgacaagacaacataggtaggtctgaaacagagagtttaag |
295 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
35163754 |
ttaaaatatggaaaggaatgtttgaaggttttgtgaagagacaacctttttggatgtagtgacaagacaacataggtaggtctgaaacagagagtttaag |
35163655 |
T |
 |
Q |
296 |
gtttgctatgttggatttttggtct |
320 |
Q |
|
|
||||||||||||||||||||||||| |
|
|
T |
35163654 |
gtttgctatgttggatttttggtct |
35163630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 102 - 142
Target Start/End: Complemental strand, 35163848 - 35163808
Alignment:
Q |
102 |
aggtaaacatagccctcagagtcggtggttaaacgaccggc |
142 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
35163848 |
aggtaaacatagccctcagagtcggtggttaaacgaccggc |
35163808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University