View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0464_high_2 (Length: 359)
Name: NF0464_high_2
Description: NF0464
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0464_high_2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 221; Significance: 1e-121; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 91 - 357
Target Start/End: Complemental strand, 51827819 - 51827552
Alignment:
Q |
91 |
gtaaattacacatcaactaatttggattgaacatttttg-gagcttttggtgaagcatgcataacataaatctggcttttttgtgactg-aaatttatca |
188 |
Q |
|
|
||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
T |
51827819 |
gtaaattcaacatcaactaatttggattgaacatttttttgagcttttggtgaagcatgcataacataaatctggcttttttgtgactggaaatttatca |
51827720 |
T |
 |
Q |
189 |
tgtcattttcttagtattaaaaattcttaatctagattctagttcattgtgcaaattgatttgcctcttgttatttattacttatgatattattattttc |
288 |
Q |
|
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
51827719 |
tgtcattttcttagtattaaaaat-cttaatctagattctagttcattgtgcaaattgatttgcctcttgttatttattacttatgatattattattttc |
51827621 |
T |
 |
Q |
289 |
ttatgttgtgtttgcagagttactgtctactcaccatatcaaagaatctgtcctgtctctgctcctcca |
357 |
Q |
|
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||| ||||| |
|
|
T |
51827620 |
ttatgttgtgtttgcagagtttctgtctactcaccatatcaaagaatctgtcctgactctgctgctcca |
51827552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 30 - 64
Target Start/End: Complemental strand, 51827878 - 51827844
Alignment:
Q |
30 |
tattcgtgattgaaatgttgaaacaatctcaaaat |
64 |
Q |
|
|
||||||||||||||||||||||||||||||||||| |
|
|
T |
51827878 |
tattcgtgattgaaatgttgaaacaatctcaaaat |
51827844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 188 - 265
Target Start/End: Complemental strand, 51824498 - 51824422
Alignment:
Q |
188 |
atgtcattttcttagtattaaaaattcttaatctagattctagttcattgtgcaaattgatttgcctcttgttattta |
265 |
Q |
|
|
||||||||||||||||| ||||| |||||| | |||||||| |||||||||||||| || ||||||||||||||| |
|
|
T |
51824498 |
atgtcattttcttagtaaagaaaat-cttaattttaattctagtccattgtgcaaattggttggcctcttgttattta |
51824422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 143 times since January 2019
Visitors: 3464