View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0464_high_4 (Length: 252)
Name: NF0464_high_4
Description: NF0464
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0464_high_4 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 7 - 223
Target Start/End: Complemental strand, 19068242 - 19068030
Alignment:
| Q |
7 |
ctgatatgaattgtgcttctcaattctaatatatgccatgaacggtttaagattagaattcttttaccaatcatgagctttgaggttctttaatagtgag |
106 |
Q |
| |
|
|||||||||| |||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
19068242 |
ctgatatgaa--gtgcttctgatttctaatatatgccatgaacggtttaagattagaattcttttaccaatcatgagctttgagattctttaatagtgag |
19068145 |
T |
|
| Q |
107 |
ctagattctcgtcgaatagtttcaaggtcttgaagaactcggcatatggtgttgtgaaacgcatgagcttcgaaaacacatgcagactttgagcaaccag |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
19068144 |
ctagattctcgtcgaatagtttcaaggtcttgaacaactcggcatatggtgttttgaaacgcatgagcttcg-aaacacatgcagactttgagcaaccag |
19068046 |
T |
|
| Q |
207 |
ggaaataaggtgtttag |
223 |
Q |
| |
|
|| |||||||||||||| |
|
|
| T |
19068045 |
gg-aataaggtgtttag |
19068030 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1581 times since January 2019
Visitors: 3458