View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0464_high_4 (Length: 252)

Name: NF0464_high_4
Description: NF0464
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0464_high_4
NF0464_high_4
[»] chr2 (1 HSPs)
chr2 (7-223)||(19068030-19068242)


Alignment Details
Target: chr2 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 7 - 223
Target Start/End: Complemental strand, 19068242 - 19068030
Alignment:
7 ctgatatgaattgtgcttctcaattctaatatatgccatgaacggtttaagattagaattcttttaccaatcatgagctttgaggttctttaatagtgag 106  Q
    ||||||||||  |||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
19068242 ctgatatgaa--gtgcttctgatttctaatatatgccatgaacggtttaagattagaattcttttaccaatcatgagctttgagattctttaatagtgag 19068145  T
107 ctagattctcgtcgaatagtttcaaggtcttgaagaactcggcatatggtgttgtgaaacgcatgagcttcgaaaacacatgcagactttgagcaaccag 206  Q
    |||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||    
19068144 ctagattctcgtcgaatagtttcaaggtcttgaacaactcggcatatggtgttttgaaacgcatgagcttcg-aaacacatgcagactttgagcaaccag 19068046  T
207 ggaaataaggtgtttag 223  Q
    || ||||||||||||||    
19068045 gg-aataaggtgtttag 19068030  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1581 times since January 2019
Visitors: 3458