View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0464_low_13 (Length: 205)
Name: NF0464_low_13
Description: NF0464
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0464_low_13 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 60; Significance: 9e-26; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 118 - 189
Target Start/End: Original strand, 42636023 - 42636094
Alignment:
Q |
118 |
agtagcataggggaaaaattgaagtaaatcagtgcattggcgatgcatgtgatacaatgctatgcaagtaat |
189 |
Q |
|
|
|||| ||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||| |
|
|
T |
42636023 |
agtaacataggggaaaaattgaagtaaatcagtgcattggtgatgcatgtgatacgatgctatgcaagtaat |
42636094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 143 - 184
Target Start/End: Original strand, 49601162 - 49601203
Alignment:
Q |
143 |
aaatcagtgcattggcgatgcatgtgatacaatgctatgcaa |
184 |
Q |
|
|
||||||||||||||| |||| ||||||| ||||||||||||| |
|
|
T |
49601162 |
aaatcagtgcattggtgatgtatgtgattcaatgctatgcaa |
49601203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University