View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0464_low_5 (Length: 278)
Name: NF0464_low_5
Description: NF0464
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0464_low_5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 179; Significance: 1e-96; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 39 - 217
Target Start/End: Complemental strand, 40440498 - 40440320
Alignment:
Q |
39 |
atgaatgagatttccagctaagtgaggtggcaattcagcagtgttggttatgccatttgggaactgaagtggaataatttggatggatgggttgagatta |
138 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40440498 |
atgaatgagatttccagctaagtgaggtggcaattcagcagtgttggttatgccatttgggaactgaagtggaataatttggatggatgggttgagatta |
40440399 |
T |
 |
Q |
139 |
agagtggatttgattttgtgaatgttggatgaagctgataagaaagttatgtgaactccttgagaaaatagcttgttgg |
217 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40440398 |
agagtggatttgattttgtgaatgttggatgaagctgataagaaagttatgtgaactccttgagaaaatagcttgttgg |
40440320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 101 - 208
Target Start/End: Complemental strand, 40443459 - 40443352
Alignment:
Q |
101 |
actgaagtggaataatttggatggatgggttgagattaagagtggatttgattttgtgaatgttggatgaagctgataagaaagttatgtgaactccttg |
200 |
Q |
|
|
|||||||||| ||||| | |||||| | ||||||||||| || | ||||||| | ||||||| |||||||||||||||||||||| | ||||||| || |
|
|
T |
40443459 |
actgaagtgggataatgttgatggacgagttgagattaaaagctgttttgattctaggaatgtttgatgaagctgataagaaagttacgcgaactccatg |
40443360 |
T |
 |
Q |
201 |
agaaaata |
208 |
Q |
|
|
||| |||| |
|
|
T |
40443359 |
agagaata |
40443352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 103 - 217
Target Start/End: Complemental strand, 21840169 - 21840055
Alignment:
Q |
103 |
tgaagtggaataatttggatggatgggttgagattaagagtggatttgattttgtgaatgttggatgaagctgataagaaagttatgtgaactccttgag |
202 |
Q |
|
|
||||| ||||| || ||||| || ||||||||||| | ||| ||||||||||| ||||||| | ||||| ||| ||||| | ||||||| ||| |||| |
|
|
T |
21840169 |
tgaaggggaatgatatggattgaagggttgagattgaaagttgatttgatttttggaatgttagctgaaggtgacaagaatgagatgtgaattccatgag |
21840070 |
T |
 |
Q |
203 |
aaaatagcttgttgg |
217 |
Q |
|
|
| |||| |||||||| |
|
|
T |
21840069 |
agaataacttgttgg |
21840055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1325 times since January 2019
Visitors: 3441