View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0466_low_2 (Length: 408)
Name: NF0466_low_2
Description: NF0466
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0466_low_2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 98; Significance: 4e-48; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 98; E-Value: 4e-48
Query Start/End: Original strand, 9 - 110
Target Start/End: Original strand, 52380221 - 52380322
Alignment:
| Q |
9 |
agcataggtgggaaaagtaatagcctattaatttgataaaaagtaccgggtacccattagtgaaaatgacaagcccggcccattaagtagtgcagtcttc |
108 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52380221 |
agcataggtgggaaaagtaatagtctattaatttgataaaaagtaccgggtacccattagtgaaaatgacaagcccggcccattaagtagtgcagtcttc |
52380320 |
T |
 |
| Q |
109 |
tc |
110 |
Q |
| |
|
|| |
|
|
| T |
52380321 |
tc |
52380322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 196 - 287
Target Start/End: Original strand, 52380399 - 52380490
Alignment:
| Q |
196 |
ggagggaaatcaaaccccccgtagaatcataaaccccaatcaatcaatcaatcaatataacacttcttcacttctgacatgcatcaacataa |
287 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52380399 |
ggagggaaatcaaaccccccgtagaatcataaaccctaatcaatcaatcaatcaatataacacttcttcacttctgacatgcatcaacataa |
52380490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University