View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0466_low_6 (Length: 253)
Name: NF0466_low_6
Description: NF0466
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0466_low_6 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 1 - 199
Target Start/End: Original strand, 37065717 - 37065912
Alignment:
| Q |
1 |
aaactcccctttgaagtaacactcactcccctctaaagggaaaatagcttcaactaattaagtaaaccaaccaataaaattaatccttttaaaactcata |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||| |
|
|
| T |
37065717 |
aaactcccctttgaagtaacactcactcccctctaaagggaaaatagcttcaactaattaagtaaaccaaccaataaaattaatc---taaaaactcata |
37065813 |
T |
|
| Q |
101 |
ttcaaagtgtgcctattttttcaactattatataaaggccgcaatatcaaactatagccttaaacacaaaatatggagatggagtggactagaggcaac |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37065814 |
ttcaaagtgtgcctattttttcaactattatataaaggccgcaatatcaaaccatagccttaaacacaaaatatggagatggagtggactagaggcaac |
37065912 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 624 times since January 2019
Visitors: 3484