View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0466_low_8 (Length: 220)
Name: NF0466_low_8
Description: NF0466
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0466_low_8 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 121; Significance: 4e-62; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 1 - 121
Target Start/End: Original strand, 31296819 - 31296939
Alignment:
| Q |
1 |
gctaatcatgttggtattaatctaggaagtcttgtatctgttgctgttgcaaatgtttctaaatcgaatttggttttgaatagtggtgaaaagttgaaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31296819 |
gctaatcatgttggtattaatctaggaagtcttgtatctgttgctgttgcaaatgtttctaaatcgaatttggttttgaatagtggtgaaaagttgaaat |
31296918 |
T |
|
| Q |
101 |
cttgggttgattatgataatg |
121 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
31296919 |
cttgggttgattatgataatg |
31296939 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 37 - 105
Target Start/End: Complemental strand, 13358527 - 13358460
Alignment:
| Q |
37 |
tctgttgctgttgcaaatgtttctaaatcgaatttggttttgaatagtggtgaaaagttgaaatcttgg |
105 |
Q |
| |
|
||||||| ||||||||| ||||| |||| |||||||||| || |||| |||||||| ||||||||||| |
|
|
| T |
13358527 |
tctgttgttgttgcaaa-gtttcaaaatagaatttggttctggatagctgtgaaaagatgaaatcttgg |
13358460 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1389 times since January 2019
Visitors: 3446