View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0467-Insertion-9 (Length: 180)
Name: NF0467-Insertion-9
Description: NF0467
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0467-Insertion-9 |
 |  |
|
[»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 149; Significance: 6e-79; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 149; E-Value: 6e-79
Query Start/End: Original strand, 8 - 180
Target Start/End: Complemental strand, 21345376 - 21345204
Alignment:
Q |
8 |
aaaagttgctgctactgccactgaaactgcagtctcaggcagggcagacgagactgtgaatgatctccttgtttgcaattgtaacttcgcatctaatcaa |
107 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||| |||||| ||||||||||||||||| |
|
|
T |
21345376 |
aaaagttgctgctactgccactgaaactgcagtctcaggcagggcaggcgagactgcgaatgatctccttgtttgtaattgtgacttcgcatctaatcaa |
21345277 |
T |
 |
Q |
108 |
gaaaatcaaatgagagcagcaaatacaccattcccttttcattttacaacatcaactgtaagttagccataag |
180 |
Q |
|
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
T |
21345276 |
gaaaataaaatgagagcagcaaatacaccattcccttttcattttacaacatcaacggtaagttagccataag |
21345204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University