View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0468_low_14 (Length: 210)
Name: NF0468_low_14
Description: NF0468
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0468_low_14 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 1 - 161
Target Start/End: Complemental strand, 20473311 - 20473151
Alignment:
Q |
1 |
tcgtgcagcagtcaatcatggtcttcatcgttacgttcgtcacaacacggttaatattgttcataagattcgtgagtttgctgatgcggttgaacgtgag |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
T |
20473311 |
tcgtgcagcagtcaatcatggtcttcatcgttacgttcgtcacaacacggttaatattgttcataagattagtgagtttgctgatgcggttgaacgtgag |
20473212 |
T |
 |
Q |
101 |
aaagattgtgctgttgttttgtatggtggttcggttaaagccccgaagattcttgctgatg |
161 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
20473211 |
aaagattgtgctgttgttttgtatggtggttcggttaaagccccgaagattcttgctgatg |
20473151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 74 - 161
Target Start/End: Complemental strand, 44256660 - 44256573
Alignment:
Q |
74 |
gagtttgctgatgcggttgaacgtgagaaagattgtgctgttgttttgtatggtggttcggttaaagccccgaagattcttgctgatg |
161 |
Q |
|
|
|||||||||| |||||||| | ||||| | | ||||| |||||||||||||||| | |||||||| |||||| |||||||||||| |
|
|
T |
44256660 |
gagtttgctgccgcggttgagcaagagaagggtcgtgctattgttttgtatggtggagcagttaaagcgccgaaggttcttgctgatg |
44256573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University