View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0468_low_4 (Length: 344)
Name: NF0468_low_4
Description: NF0468
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0468_low_4 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 276; Significance: 1e-154; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 276; E-Value: 1e-154
Query Start/End: Original strand, 22 - 332
Target Start/End: Original strand, 2332181 - 2332489
Alignment:
| Q |
22 |
catcatcagaagacgacgaaataaaatttctggtttgaatgtggaaaacatatggtgcacgaatgcaagcactctcaaaagggaagcctcaaagtttttt |
121 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2332181 |
catcatcagaagacggcgaaataaaatttctggtttgaatgtggaaaacat--ggtgcacgaatgcaagcactctcaaaagggaagcctcaaagtttttt |
2332278 |
T |
 |
| Q |
122 |
atgaatctattccaatcaaatgatccctgtaaacctctcatatagtttacaactggataatattccatctcttagcattaacttgatggaccagcttctc |
221 |
Q |
| |
|
||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||| |
|
|
| T |
2332279 |
atgcatctatcccaatcaaatgatccctgtaaacctctcatatagtttacaactggataatattccatctcttggcattagcttgatggaccagcttctc |
2332378 |
T |
 |
| Q |
222 |
ttgcctgtaactatggaaaggattaaagattctattttccctatgcactcttacaaagccctaggacatgatggatttcaaccgatattttacaaaattt |
321 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2332379 |
ttgcctgtcactatggaaaggattaaagattctattttccctatgcactcttacaaagccctaggacatgatggatttcaaccgatattttacaaaattt |
2332478 |
T |
 |
| Q |
322 |
gttggcatatt |
332 |
Q |
| |
|
||||||||||| |
|
|
| T |
2332479 |
gttggcatatt |
2332489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 246 - 332
Target Start/End: Complemental strand, 1261909 - 1261823
Alignment:
| Q |
246 |
aaagattctattttccctatgcactcttacaaagccctaggacatgatggatttcaaccgatattttacaaaatttgttggcatatt |
332 |
Q |
| |
|
|||||| |||||||| | ||||||||||||||||||| || | ||||| |||||||| || |||| ||||| || |||||||||| |
|
|
| T |
1261909 |
aaagatgctattttctcaatgcactcttacaaagccccgggtccagatggttttcaacctatttttttcaaaacttattggcatatt |
1261823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University