View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0468_low_6 (Length: 290)
Name: NF0468_low_6
Description: NF0468
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0468_low_6 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 56; Significance: 3e-23; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 153 - 216
Target Start/End: Complemental strand, 26496061 - 26495998
Alignment:
Q |
153 |
ttgatcctattctatagctatatcttctcttacgttctttttcgttatcatcttcattaatatt |
216 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
T |
26496061 |
ttgatcctattctatagctatatcttctcttacgttcttttttcttatcatcttcattaatatt |
26495998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University