View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0468_low_8 (Length: 267)
Name: NF0468_low_8
Description: NF0468
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0468_low_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 29 - 263
Target Start/End: Original strand, 36599328 - 36599546
Alignment:
Q |
29 |
agtttttcatctatatgatatgatgtaattgaagtgtactgttataaacttatgagcattaattaattgggaaaaaataaatatatttctaagagaatga |
128 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||| |
|
|
T |
36599328 |
agtttttcatctatatgatatgatgtaattgaagtgtactgttataaacttatgagcattaatt----gggaaaaaataa------------gagaatga |
36599411 |
T |
 |
Q |
129 |
ggtttgaggagtttgctataggaacattgaattgaatggttttcacaagaaagatgagtaaagttacattccacagttatgacaataactacctctcaaa |
228 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
36599412 |
ggtttgaggagtttgctataggaacattgaattgaatggttttcacaagaaagatgagtaaagttacattccacagttatgacaataactacctctcaaa |
36599511 |
T |
 |
Q |
229 |
ggactaaatgagagagtggcaaagtataatctacc |
263 |
Q |
|
|
||| |||||||||||| ||||||||||||| |||| |
|
|
T |
36599512 |
ggattaaatgagagaggggcaaagtataatatacc |
36599546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University