View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0469_low_15 (Length: 251)
Name: NF0469_low_15
Description: NF0469
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0469_low_15 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 1 - 150
Target Start/End: Original strand, 4712528 - 4712679
Alignment:
Q |
1 |
agcatttttgtttttgtaattaatttgagtaagcgcagttcaaatgataaaaagttgcgagacatttgatatgtagaagcgcaaattctaatcaacaatg |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
4712528 |
agcatttttgtttttgtaattaatttgagtaagcgcagttcaaatgataaaaagttgcgagacatttgatatgtagaagcgcaaattctaatcaacaatg |
4712627 |
T |
 |
Q |
101 |
ttcaagttcttcacattta--gtgtgtgagtttagttaccggactatttgcc |
150 |
Q |
|
|
||||||||||||||||||| |||||||||||||||||||| |||||||||| |
|
|
T |
4712628 |
ttcaagttcttcacatttagtgtgtgtgagtttagttaccgaactatttgcc |
4712679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University