View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0469_low_20 (Length: 206)
Name: NF0469_low_20
Description: NF0469
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0469_low_20 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 73; Significance: 2e-33; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 24 - 116
Target Start/End: Complemental strand, 39173613 - 39173521
Alignment:
| Q |
24 |
gtcatatcttgctaatgttctgattgcatttcttaaccatgagatatattacttttaactttgtgtcagaactcagttttcgcttcatctcac |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||| ||| |||||||||||| ||||||||||| |
|
|
| T |
39173613 |
gtcatatcttgctaatgttctgattgcatttcttaatcatgagatatattactttaaactttgtatcataactcagttttcacttcatctcac |
39173521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 60; Significance: 9e-26; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 129 - 200
Target Start/End: Original strand, 42636023 - 42636094
Alignment:
| Q |
129 |
agtagcataggggaaaaattgaagtaaatcagtgcattggcgatgcatgtgatacaatgctatgcaagtaat |
200 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
42636023 |
agtaacataggggaaaaattgaagtaaatcagtgcattggtgatgcatgtgatacgatgctatgcaagtaat |
42636094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 154 - 195
Target Start/End: Original strand, 49601162 - 49601203
Alignment:
| Q |
154 |
aaatcagtgcattggcgatgcatgtgatacaatgctatgcaa |
195 |
Q |
| |
|
||||||||||||||| |||| ||||||| ||||||||||||| |
|
|
| T |
49601162 |
aaatcagtgcattggtgatgtatgtgattcaatgctatgcaa |
49601203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University