View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0469_low_20 (Length: 206)

Name: NF0469_low_20
Description: NF0469
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0469_low_20
NF0469_low_20
[»] chr1 (1 HSPs)
chr1 (24-116)||(39173521-39173613)
[»] chr3 (1 HSPs)
chr3 (129-200)||(42636023-42636094)
[»] chr4 (1 HSPs)
chr4 (154-195)||(49601162-49601203)


Alignment Details
Target: chr1 (Bit Score: 73; Significance: 2e-33; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 24 - 116
Target Start/End: Complemental strand, 39173613 - 39173521
Alignment:
24 gtcatatcttgctaatgttctgattgcatttcttaaccatgagatatattacttttaactttgtgtcagaactcagttttcgcttcatctcac 116  Q
    |||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||| ||| |||||||||||| |||||||||||    
39173613 gtcatatcttgctaatgttctgattgcatttcttaatcatgagatatattactttaaactttgtatcataactcagttttcacttcatctcac 39173521  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 60; Significance: 9e-26; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 129 - 200
Target Start/End: Original strand, 42636023 - 42636094
Alignment:
129 agtagcataggggaaaaattgaagtaaatcagtgcattggcgatgcatgtgatacaatgctatgcaagtaat 200  Q
    |||| ||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||    
42636023 agtaacataggggaaaaattgaagtaaatcagtgcattggtgatgcatgtgatacgatgctatgcaagtaat 42636094  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 154 - 195
Target Start/End: Original strand, 49601162 - 49601203
Alignment:
154 aaatcagtgcattggcgatgcatgtgatacaatgctatgcaa 195  Q
    ||||||||||||||| |||| ||||||| |||||||||||||    
49601162 aaatcagtgcattggtgatgtatgtgattcaatgctatgcaa 49601203  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University