View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0469_low_21 (Length: 206)
Name: NF0469_low_21
Description: NF0469
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0469_low_21 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 125; Significance: 1e-64; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 125; E-Value: 1e-64
Query Start/End: Original strand, 1 - 125
Target Start/End: Original strand, 37155721 - 37155845
Alignment:
Q |
1 |
agtttcgacggctagatggttatcagggattgaatcgtcggcaagagaacgagaaacagtccggagtttaagatgatctgaggtcggaacaccttcagga |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
37155721 |
agtttcgacggctagatggttatcagggattgaatcgtcggcaagagaacgagaaacagtccggagtttaagatgatctgaggtcggaacaccttcagga |
37155820 |
T |
 |
Q |
101 |
caatattcagctaagtaccattctc |
125 |
Q |
|
|
||||||||||||||||||||||||| |
|
|
T |
37155821 |
caatattcagctaagtaccattctc |
37155845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 77; E-Value: 6e-36
Query Start/End: Original strand, 1 - 125
Target Start/End: Original strand, 37161322 - 37161446
Alignment:
Q |
1 |
agtttcgacggctagatggttatcagggattgaatcgtcggcaagagaacgagaaacagtccggagtttaagatgatctgaggtcggaacaccttcagga |
100 |
Q |
|
|
|||||| || |||||||| ||||||||||||||||| |||||||||||| |||| ||||| ||||||||||||||||||||||| ||||||||||||| |
|
|
T |
37161322 |
agtttcaactgctagatgattatcagggattgaatcatcggcaagagaaagagacacagtacggagtttaagatgatctgaggttggaacaccttcagtg |
37161421 |
T |
 |
Q |
101 |
caatattcagctaagtaccattctc |
125 |
Q |
|
|
||||| |||||||||||||||||| |
|
|
T |
37161422 |
gaatatccagctaagtaccattctc |
37161446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 1 - 124
Target Start/End: Original strand, 37150595 - 37150718
Alignment:
Q |
1 |
agtttcgacggctagatggttatcagggattgaatcgtcggcaagagaacgagaaacagtccggagtttaagatgatctgaggtcggaacaccttcagga |
100 |
Q |
|
|
|||||||||| |||||||| |||||||||||| || | |||||||||| |||||||||| ||||||||||||||||| || || |||||||| |||||| |
|
|
T |
37150595 |
agtttcgacgattagatggtcatcagggattgattcatgggcaagagaaagagaaacagtgcggagtttaagatgatccgacgttggaacaccctcagga |
37150694 |
T |
 |
Q |
101 |
caatattcagctaagtaccattct |
124 |
Q |
|
|
| ||| |||||| |||||||||| |
|
|
T |
37150695 |
gagtatgcagctacgtaccattct |
37150718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 551 times since January 2019
Visitors: 3483