View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0469_low_4 (Length: 353)
Name: NF0469_low_4
Description: NF0469
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0469_low_4 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 82 - 287
Target Start/End: Complemental strand, 24270241 - 24270036
Alignment:
| Q |
82 |
cagaacctgtgctgttcaccaaaaagaaaaacatggcgagtggtaggcaaattggtgtagctttagatttctccaaaggaagcaagatcgctctcaaatg |
181 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24270241 |
cagaacttgtgctgttcaccaaaaagaaaaacatggcgagtggaaggcaaattggtgtagctttagatttctccaaaggaagcaagatcgctctcaaatg |
24270142 |
T |
|
| Q |
182 |
ggctatcgataatcttcttcgtaccggtgatacactctatatcgttcatgtcaatcattcccatcccactgaatctcgtaatcttctttgggcaaccaca |
281 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24270141 |
ggctatcgacaatcttcttcgtaccggtgatacactctatatcgttcatgtcaatcattcccatcccactgaatctcgtaatcttctttgggcaaccact |
24270042 |
T |
|
| Q |
282 |
ggttct |
287 |
Q |
| |
|
|||||| |
|
|
| T |
24270041 |
ggttct |
24270036 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1622 times since January 2019
Visitors: 3460