View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0470_high_2 (Length: 412)
Name: NF0470_high_2
Description: NF0470
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0470_high_2 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 15 - 323
Target Start/End: Original strand, 10927828 - 10928138
Alignment:
| Q |
15 |
gagggagggtcatcttgatattcttgagacattaattaatgcaggtgcatcccagccagcatgtgaagaagctcttctggaggcaagttaccatgggcaa |
114 |
Q |
| |
|
||||||||| || ||||||||||||||||| |||||||||||||| |||||||||| ||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10927828 |
gagggaggggcaccttgatattcttgagaccttaattaatgcaggggcatcccagctagcttgtgaagaagctcttctggaggcaagttaccatgggcaa |
10927927 |
T |
 |
| Q |
115 |
gcagggtgtggggaattgctcatgagctctgatttgatccgaccgcatattgccgtacatgctcttgtagccgcatgctgcagggggtttgtcgatgtgg |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||| ||||||||||||||||||||||| ||||||| |
|
|
| T |
10927928 |
gcagggtgtggggaattgctcatgagctctgattttatccgaccgcatattgctgtacatgctcttgtggccgcatgctgcagggggtttgtagatgtgg |
10928027 |
T |
 |
| Q |
215 |
ttgagacactcataaaggtacgtgttctgcagca----gcatgattctagagattttgtaatggatactctgaactgatatatgatccagaagcatctgc |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||| |||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
10928028 |
ttgagacactcataaaggtacgtgttctgcagcagcatgcatgattatagagattttgtaacggatactctgaa--gatatatgatccagaagcatctgc |
10928125 |
T |
 |
| Q |
311 |
aattgttctgtct |
323 |
Q |
| |
|
| ||||| ||||| |
|
|
| T |
10928126 |
atttgttttgtct |
10928138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 45; Significance: 2e-16; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 342 - 394
Target Start/End: Original strand, 229924 - 229976
Alignment:
| Q |
342 |
gcaggaactggagctggagtagttgctggaggagatgagagtggagtaggtgt |
394 |
Q |
| |
|
|||||| | |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
229924 |
gcaggagcgggagctggagtagttgctggaggagatgagagtggagtaggtgt |
229976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University