View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0470_high_2 (Length: 412)

Name: NF0470_high_2
Description: NF0470
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0470_high_2
NF0470_high_2
[»] chr7 (1 HSPs)
chr7 (15-323)||(10927828-10928138)
[»] chr5 (1 HSPs)
chr5 (342-394)||(229924-229976)


Alignment Details
Target: chr7 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 15 - 323
Target Start/End: Original strand, 10927828 - 10928138
Alignment:
15 gagggagggtcatcttgatattcttgagacattaattaatgcaggtgcatcccagccagcatgtgaagaagctcttctggaggcaagttaccatgggcaa 114  Q
    ||||||||| || ||||||||||||||||| |||||||||||||| |||||||||| ||| |||||||||||||||||||||||||||||||||||||||    
10927828 gagggaggggcaccttgatattcttgagaccttaattaatgcaggggcatcccagctagcttgtgaagaagctcttctggaggcaagttaccatgggcaa 10927927  T
115 gcagggtgtggggaattgctcatgagctctgatttgatccgaccgcatattgccgtacatgctcttgtagccgcatgctgcagggggtttgtcgatgtgg 214  Q
    ||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||| ||||||||||||||||||||||| |||||||    
10927928 gcagggtgtggggaattgctcatgagctctgattttatccgaccgcatattgctgtacatgctcttgtggccgcatgctgcagggggtttgtagatgtgg 10928027  T
215 ttgagacactcataaaggtacgtgttctgcagca----gcatgattctagagattttgtaatggatactctgaactgatatatgatccagaagcatctgc 310  Q
    ||||||||||||||||||||||||||||||||||    |||||||| |||||||||||||| ||||||||||||  ||||||||||||||||||||||||    
10928028 ttgagacactcataaaggtacgtgttctgcagcagcatgcatgattatagagattttgtaacggatactctgaa--gatatatgatccagaagcatctgc 10928125  T
311 aattgttctgtct 323  Q
    | ||||| |||||    
10928126 atttgttttgtct 10928138  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 45; Significance: 2e-16; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 342 - 394
Target Start/End: Original strand, 229924 - 229976
Alignment:
342 gcaggaactggagctggagtagttgctggaggagatgagagtggagtaggtgt 394  Q
    |||||| | ||||||||||||||||||||||||||||||||||||||||||||    
229924 gcaggagcgggagctggagtagttgctggaggagatgagagtggagtaggtgt 229976  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 302 times since January 2019
Visitors: 3469