View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0470_low_6 (Length: 231)
Name: NF0470_low_6
Description: NF0470
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0470_low_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 112; Significance: 9e-57; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 112; E-Value: 9e-57
Query Start/End: Original strand, 1 - 141
Target Start/End: Original strand, 15525129 - 15525275
Alignment:
| Q |
1 |
gcgtttgttcaattattcaagaatagtttaaccattgtacttaaagcattgaatctagaataggataaacatacaatggaacat------tcataactga |
94 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||| |
|
|
| T |
15525129 |
gcgtttgttcaattattcaagaacagtttaaccattgtacttaaagcattgaatctaaaataggataaacatacaatggaacattcataatcataactga |
15525228 |
T |
|
| Q |
95 |
tatctggcacacaataatgaaacaaattagtaatgcgaggatacctc |
141 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
15525229 |
tatctggcacacaataatgaaacaaattattaatgcgaggatacctc |
15525275 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 42 - 92
Target Start/End: Original strand, 15544728 - 15544778
Alignment:
| Q |
42 |
taaagcattgaatctagaataggataaacatacaatggaacattcataact |
92 |
Q |
| |
|
|||||||||||| ||| ||||| ||||||||| ||||||||||||| |||| |
|
|
| T |
15544728 |
taaagcattgaaactataatagcataaacataaaatggaacattcaaaact |
15544778 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 124 times since January 2019
Visitors: 3464