View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0470_low_6 (Length: 231)

Name: NF0470_low_6
Description: NF0470
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0470_low_6
NF0470_low_6
[»] chr4 (2 HSPs)
chr4 (1-141)||(15525129-15525275)
chr4 (42-92)||(15544728-15544778)


Alignment Details
Target: chr4 (Bit Score: 112; Significance: 9e-57; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 112; E-Value: 9e-57
Query Start/End: Original strand, 1 - 141
Target Start/End: Original strand, 15525129 - 15525275
Alignment:
1 gcgtttgttcaattattcaagaatagtttaaccattgtacttaaagcattgaatctagaataggataaacatacaatggaacat------tcataactga 94  Q
    ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||      ||||||||||    
15525129 gcgtttgttcaattattcaagaacagtttaaccattgtacttaaagcattgaatctaaaataggataaacatacaatggaacattcataatcataactga 15525228  T
95 tatctggcacacaataatgaaacaaattagtaatgcgaggatacctc 141  Q
    ||||||||||||||||||||||||||||| |||||||||||||||||    
15525229 tatctggcacacaataatgaaacaaattattaatgcgaggatacctc 15525275  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 42 - 92
Target Start/End: Original strand, 15544728 - 15544778
Alignment:
42 taaagcattgaatctagaataggataaacatacaatggaacattcataact 92  Q
    |||||||||||| ||| ||||| ||||||||| ||||||||||||| ||||    
15544728 taaagcattgaaactataatagcataaacataaaatggaacattcaaaact 15544778  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 124 times since January 2019
Visitors: 3464