View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0470_low_7 (Length: 206)
Name: NF0470_low_7
Description: NF0470
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0470_low_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 117 - 158
Target Start/End: Complemental strand, 38455245 - 38455204
Alignment:
Q |
117 |
gatggaacaaacgcaccattgatgttgcaccctatcattcat |
158 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
38455245 |
gatggaacaaacgcaccattgatgttgcaccctatcattcat |
38455204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1648 times since January 2019
Visitors: 3461