View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0471_high_3 (Length: 312)
Name: NF0471_high_3
Description: NF0471
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0471_high_3 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 29 - 225
Target Start/End: Original strand, 37089549 - 37089745
Alignment:
| Q |
29 |
gagaggatgaaatctatgagtactggtctttttctatgtacactttcaatgggatattttgttagtagtttattggtttcaattgtggacaaagtaagca |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37089549 |
gagaggatgaaatctatgagtactggtctttttctatgtacactttcaatgggatattttgttagtagtttattggtttcaattgtggacaaagtaagca |
37089648 |
T |
|
| Q |
129 |
agaaaagatggttgaagagtaatcttgataagggtaagttagattacttctattggttactagcaattcttggagtgctgaattttgtactttttct |
225 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37089649 |
agaaaagatggttgaagagtaatcttgataagggtaagttagattacttctattggttactagcaattcttggagtgctgaattttgtactttttct |
37089745 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1751 times since January 2019
Visitors: 3462