View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0471_low_6 (Length: 312)

Name: NF0471_low_6
Description: NF0471
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0471_low_6
NF0471_low_6
[»] chr5 (1 HSPs)
chr5 (29-225)||(37089549-37089745)


Alignment Details
Target: chr5 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 29 - 225
Target Start/End: Original strand, 37089549 - 37089745
Alignment:
29 gagaggatgaaatctatgagtactggtctttttctatgtacactttcaatgggatattttgttagtagtttattggtttcaattgtggacaaagtaagca 128  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37089549 gagaggatgaaatctatgagtactggtctttttctatgtacactttcaatgggatattttgttagtagtttattggtttcaattgtggacaaagtaagca 37089648  T
129 agaaaagatggttgaagagtaatcttgataagggtaagttagattacttctattggttactagcaattcttggagtgctgaattttgtactttttct 225  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37089649 agaaaagatggttgaagagtaatcttgataagggtaagttagattacttctattggttactagcaattcttggagtgctgaattttgtactttttct 37089745  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University