View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0472_low_1 (Length: 278)
Name: NF0472_low_1
Description: NF0472
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0472_low_1 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 183; Significance: 5e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 183; E-Value: 5e-99
Query Start/End: Original strand, 53 - 235
Target Start/End: Complemental strand, 11575909 - 11575727
Alignment:
| Q |
53 |
catcaaaagatttagatgttcctttagcactcctcaatattgagctagatgatagggatgacctgagttgaggggatggtgttctcttaggcaagaatcc |
152 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11575909 |
catcaaaagatttagatgttcctttagcactcctcaatattgagctagatgatagggatgacctgagttgaggggatggtgttctcttaggcaagaatcc |
11575810 |
T |
|
| Q |
153 |
attagaggttaattttgagatattatcaactccacctagtgattggcgacgagaagaaccattgttcatacttcttccctctg |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11575809 |
attagaggttaattttgagatattatcaactccacctagtgattggcgacgagaagaaccattgttcatacttcttccctctg |
11575727 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 67; Significance: 8e-30; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 53 - 207
Target Start/End: Complemental strand, 7519607 - 7519453
Alignment:
| Q |
53 |
catcaaaagatttagatgttcctttagcactcctcaatattgagctagatgatagggatgacctgagttgaggggatggtgttctcttaggcaagaatcc |
152 |
Q |
| |
|
||||||||||||||||||||||||| ||| || |||||| ||||||||| ||| |||||||||| | |||| ||||||| | ||||||||| || || |
|
|
| T |
7519607 |
catcaaaagatttagatgttcctttggcattcttcaatactgagctagaagatggggatgaccttaattgaaaggatggtaaccgcttaggcaaaaaccc |
7519508 |
T |
|
| Q |
153 |
attagaggttaattttgagatattatcaactccacctagtgattggcgacgagaa |
207 |
Q |
| |
|
|||||||||| |||||||| ||||||| |||||||||| ||||| ||||||||| |
|
|
| T |
7519507 |
attagaggttggttttgagaaattatcagctccacctagagattgccgacgagaa |
7519453 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1374 times since January 2019
Visitors: 3446