View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0473_low_3 (Length: 286)
Name: NF0473_low_3
Description: NF0473
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0473_low_3 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 48 - 221
Target Start/End: Complemental strand, 4309921 - 4309745
Alignment:
| Q |
48 |
cacagagaatcgattttccgatcgctttccaatggcgacggcgac------aaaacctcaacgaactccacaggaagtagaagacataatcatccgcaaa |
141 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4309921 |
cacagagaatcgattttccgatcattttccaatggcgacggcgacggcgacaaaacctcaacgaactccacaggaagtagaagacataatcatccgcaaa |
4309822 |
T |
|
| Q |
142 |
atcttcctcgtcagcatcaccggagaatcaacaaccaccaccaccggagcaaccgattcgagaatcgtttatctcgaact |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4309821 |
atcttcctcgtcagcatcaccggagaatcaacaaccac---caccggagcaaccgattcgagaatcgtttatctcgaact |
4309745 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1635 times since January 2019
Visitors: 3460