View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0474_low_3 (Length: 446)
Name: NF0474_low_3
Description: NF0474
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0474_low_3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 61; Significance: 5e-26; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 220 - 320
Target Start/End: Complemental strand, 228243 - 228136
Alignment:
Q |
220 |
gctctcattgaaat-gtccaatgaaatgtaatatacaaatca------gacctgatgtggttgtatctacatatataaaatttcctcaatagcaccatga |
312 |
Q |
|
|
||||||||| |||| ||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
T |
228243 |
gctctcatttaaattgtccaatgaaatgcaatatacaaatcaaaatgtgacctgatgtggttgtatctacatatataaaatttcctcaaaagcaccatga |
228144 |
T |
 |
Q |
313 |
attcgtta |
320 |
Q |
|
|
||||||| |
|
|
T |
228143 |
tttcgtta |
228136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 275 - 334
Target Start/End: Original strand, 256124 - 256182
Alignment:
Q |
275 |
gtatctacatatataaaatttcctcaatagcaccatgaattcgttaaattcttcttgatt |
334 |
Q |
|
|
|||||||| |||||||| |||| ||||||||||||||||||| ||||||||||||||||| |
|
|
T |
256124 |
gtatctacgtatataaattttc-tcaatagcaccatgaattccttaaattcttcttgatt |
256182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 30 - 67
Target Start/End: Original strand, 256033 - 256070
Alignment:
Q |
30 |
ctttttctttctcaaaattttctgcatggtgaattata |
67 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||| |
|
|
T |
256033 |
ctttttctttctcaaaattttctgcatggtgaattata |
256070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1530 times since January 2019
Visitors: 3457