View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0474_low_4 (Length: 411)
Name: NF0474_low_4
Description: NF0474
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0474_low_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 96; Significance: 6e-47; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 96; E-Value: 6e-47
Query Start/End: Original strand, 287 - 382
Target Start/End: Original strand, 56233047 - 56233142
Alignment:
Q |
287 |
tgcagcctaagaagttgaaatttgacaaaattggtgaagagaagagttttagtttgacaattgaagttactagatcaggtatggctactgtatttg |
382 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
56233047 |
tgcagcctaagaagttgaaatttgacaaaattggtgaagagaagagttttagtttgacaattgaagttactagatcaggtatggctactgtatttg |
56233142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 84; Significance: 9e-40; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 84; E-Value: 9e-40
Query Start/End: Original strand, 287 - 382
Target Start/End: Original strand, 39190994 - 39191089
Alignment:
Q |
287 |
tgcagcctaagaagttgaaatttgacaaaattggtgaagagaagagttttagtttgacaattgaagttactagatcaggtatggctactgtatttg |
382 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||| |
|
|
T |
39190994 |
tgcagcctaagaagttgaaatttgacaaaattggtgaagagaagagttttaatttgacaattgaagttactagatcaggtggggctactgtatttg |
39191089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1467 times since January 2019
Visitors: 3452