View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0474_low_8 (Length: 216)
Name: NF0474_low_8
Description: NF0474
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0474_low_8 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 113; Significance: 2e-57; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 1 - 129
Target Start/End: Original strand, 13020925 - 13021053
Alignment:
Q |
1 |
gaagaagaagaagtatcatcctgttgctggtactgtattcaatcagatgatgaacttcaacaggcttcatcattatatgactgatcttgcaaggaggtac |
100 |
Q |
|
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||| |
|
|
T |
13020925 |
gaagaagaagaagtatcatcctgttgctggcactgtattcaatcagatgatgaacttcaacagacttcatcattatatgactgatcttgcaaggaaatac |
13021024 |
T |
 |
Q |
101 |
aagacatacaggttacttaaccctttcag |
129 |
Q |
|
|
||||||||||||||||||||||||||||| |
|
|
T |
13021025 |
aagacatacaggttacttaaccctttcag |
13021053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 97; E-Value: 8e-48
Query Start/End: Original strand, 1 - 129
Target Start/End: Complemental strand, 13072918 - 13072790
Alignment:
Q |
1 |
gaagaagaagaagtatcatcctgttgctggtactgtattcaatcagatgatgaacttcaacaggcttcatcattatatgactgatcttgcaaggaggtac |
100 |
Q |
|
|
||||||||| |||||||||||||||||||| ||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||| ||| |
|
|
T |
13072918 |
gaagaagaaaaagtatcatcctgttgctggcactgtattcaatcagatgatgaatttcaacagacttcatcattatatgactgatcttgcaaggaaatac |
13072819 |
T |
 |
Q |
101 |
aagacatacaggttacttaaccctttcag |
129 |
Q |
|
|
| |||||||||| |||||||||||||||| |
|
|
T |
13072818 |
aggacatacaggctacttaaccctttcag |
13072790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University