View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0475_low_13 (Length: 247)
Name: NF0475_low_13
Description: NF0475
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0475_low_13 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 101; Significance: 4e-50; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 26 - 244
Target Start/End: Original strand, 40368140 - 40368360
Alignment:
| Q |
26 |
ccaaagtgggttgtgcttttttgtttaccaacaaaagcagcagaaaagggcttgctatgcttaacgcataagaaacttgtcactgg-----nnnnnnnnn |
120 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
40368140 |
ccaaagtgggttgtgctttt-tgtttaccaacaaaagcagcagaaaagggcttgctatacttaacgcataagaaacttgtcactggtttttttttttttt |
40368238 |
T |
|
| Q |
121 |
nncacttgtagnnnnnnngaattaaacggggggtcacttgaagttaattcatatccctagccctagggtacataatagtttaannnnnnnnatcatttac |
220 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||| |
|
|
| T |
40368239 |
ttcacttgtagttttttttaattaaacggggggtcacttgaagttaattcatatccctagccctagggtacataatagtttaa--ttttttataatttac |
40368336 |
T |
|
| Q |
221 |
ttaattgcaactatatttatgtat |
244 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
40368337 |
ttaattgcaactatatttatgtat |
40368360 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 523 times since January 2019
Visitors: 3481