View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0475_low_7 (Length: 313)
Name: NF0475_low_7
Description: NF0475
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0475_low_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 201; Significance: 1e-109; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 201; E-Value: 1e-109
Query Start/End: Original strand, 36 - 255
Target Start/End: Original strand, 53956299 - 53956516
Alignment:
| Q |
36 |
agtttgagtaagaatcattcattgctccaaaggtcagaaaaattaaaatttaattacaccagtaaagcaatatttgatcacaatattaagttaagcttaa |
135 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53956299 |
agtttgagtaagaatcattcattgctccaaaggtcagaaaaattaaaatttaattacaccagtaaagcaatatttgatcacaatattaagttaagcttaa |
53956398 |
T |
 |
| Q |
136 |
tctaacggtactgtctttaattctttaaggtatttctggatgtttttagtttcataatcttattcacctaaataaaagtagacagacacataaattttcc |
235 |
Q |
| |
|
| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
53956399 |
tttaacggtactgtctttaattctttatggtatttctggatgtttttagtttcataatcttattcacctaaataaaagtagacag--acataaattttcc |
53956496 |
T |
 |
| Q |
236 |
ataatcctaacctttgcttc |
255 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
53956497 |
ataatcctaacctttgcttc |
53956516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University