View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0475_low_8 (Length: 291)
Name: NF0475_low_8
Description: NF0475
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0475_low_8 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 211; Significance: 1e-115; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 29 - 284
Target Start/End: Original strand, 5524868 - 5525123
Alignment:
| Q |
29 |
aagtttctcttcaatctaatttagtactctctcatttccattcatacatatattnnnnnnntgacaaacaataccaccatccaccctcaagccaaaacca |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5524868 |
aagtttctcttcaatctaatttagtactctctcatttccattcatacatatattaaaaaaatgacaaacaataccaccatccaccctcaagccaaaacca |
5524967 |
T |
 |
| Q |
129 |
ccaccaacggcggtgcagccaccgccgttaaaccctcattcccggcgacaaaagcgcaaatctacggtgcaacccggccaacctaccgtccacaaaccca |
228 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||| ||||||||||||||||||||||| |
|
|
| T |
5524968 |
ccaccaacggtggtgcagccaccgccgttaaaccctcattcccggcgacaaaagcgcaaatctacggcgccacccgcccaacctaccgtccacaaaccca |
5525067 |
T |
 |
| Q |
229 |
ccgttaccgtaacaaccgtaactggtgttgcaccatttgttgctggcttcatctca |
284 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
5525068 |
ccgtcaccgtaacaaccgtaactggtgttgcaccatttgttgctggcttcttctca |
5525123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University