View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0478-INSERTION-10 (Length: 110)
Name: NF0478-INSERTION-10
Description: NF0478
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0478-INSERTION-10 |
![](./plan/images/spacer.gif) | ![NF0478-INSERTION-10](./plan/images/spacer.gif) |
|
[»] chr6 (1 HSPs) |
![](./plan/images/spacer.gif) | ![chr6 (1-110)||(7815015-7815128)](./plan/images/spacer.gif) |
|
[»] chr4 (2 HSPs) |
![](./plan/images/spacer.gif) | ![chr4 (1-110)||(18157118-18157231)](./plan/images/spacer.gif) |
|
Alignment Details
Target: chr6 (Bit Score: 93; Significance: 9e-46; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 93; E-Value: 9e-46
Query Start/End: Original strand, 1 - 110
Target Start/End: Original strand, 7815015 - 7815128
Alignment:
Q |
1 |
aatttttcgttgaatctgagacgaaaatatttataacattttagagaacaaacttcccgatgcttaga----agcatcaaactagtcccttattcctaca |
96 |
Q |
|
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
T |
7815015 |
aatttttcgttgaatctgagacgaaaatatttacaacattttagagaacaaacttcccgatgcttagaatttagcatcaaactagtcccttattcctaca |
7815114 |
T |
![](./plan/images/spacer.gif) |
Q |
97 |
ctagcttgtgctgg |
110 |
Q |
|
|
|||||||||||||| |
|
|
T |
7815115 |
ctagcttgtgctgg |
7815128 |
T |
![](./plan/images/spacer.gif) |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 93; Significance: 9e-46; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 93; E-Value: 9e-46
Query Start/End: Original strand, 1 - 110
Target Start/End: Complemental strand, 18157231 - 18157118
Alignment:
Q |
1 |
aatttttcgttgaatctgagacgaaaatatttataacattttagagaacaaacttcccgatgcttaga----agcatcaaactagtcccttattcctaca |
96 |
Q |
|
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
T |
18157231 |
aatttttcgttgaatctgagacgaaaatatttacaacattttagagaacaaacttcccgatgcttagaatttagcatcaaactagtcccttattcctaca |
18157132 |
T |
![](./plan/images/spacer.gif) |
Q |
97 |
ctagcttgtgctgg |
110 |
Q |
|
|
|||||||||||||| |
|
|
T |
18157131 |
ctagcttgtgctgg |
18157118 |
T |
![](./plan/images/spacer.gif) |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.00000000003
Query Start/End: Original strand, 19 - 61
Target Start/End: Original strand, 37692135 - 37692177
Alignment:
Q |
19 |
agacgaaaatatttataacattttagagaacaaacttcccgat |
61 |
Q |
|
|
||||||||||||||||||||||||| ||||||||| ||||||| |
|
|
T |
37692135 |
agacgaaaatatttataacattttacagaacaaacatcccgat |
37692177 |
T |
![](./plan/images/spacer.gif) |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 33; Significance: 0.0000000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.0000000005
Query Start/End: Original strand, 1 - 69
Target Start/End: Original strand, 50428770 - 50428838
Alignment:
Q |
1 |
aatttttcgttgaatctgagacgaaaatatttataacattttagagaacaaacttcccgatgcttagaa |
69 |
Q |
|
|
|||||||| ||||||| ||||||||| ||||||| ||||||||||| ||||| |||| | |||||||| |
|
|
T |
50428770 |
aatttttcattgaatccaagacgaaaaaatttatagcattttagagagcaaacctcccaacgcttagaa |
50428838 |
T |
![](./plan/images/spacer.gif) |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 10893 times since January 2019
Visitors: 1277