View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0478-INSERTION-11 (Length: 129)
Name: NF0478-INSERTION-11
Description: NF0478
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0478-INSERTION-11 |
| |
|
[»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 113; Significance: 1e-57; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 113; E-Value: 1e-57
Query Start/End: Original strand, 1 - 129
Target Start/End: Original strand, 51919113 - 51919241
Alignment:
Q |
1 |
gtatagagtgcaacaatttattcaaattgtaatttgcatcccccacattttatattttgtctcggtatacgtacgatgcatattcacgggtttttagctc |
100 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
T |
51919113 |
gtatagagtgcaacaatttattcaaattgtaatttgcatcccccacattttatattttgtctcggtatacgtacgatgcatgttcacgggtttttagctc |
51919212 |
T |
|
Q |
101 |
aataaactaagtgatgcatgtattatttg |
129 |
Q |
|
|
|||| |||||||||||| ||| ||||||| |
|
|
T |
51919213 |
aatagactaagtgatgcgtgtcttatttg |
51919241 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 9777 times since January 2019
Visitors: 1248