View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0478-INSERTION-2 (Length: 150)
Name: NF0478-INSERTION-2
Description: NF0478
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0478-INSERTION-2 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 96; Significance: 2e-47; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 96; E-Value: 2e-47
Query Start/End: Original strand, 1 - 145
Target Start/End: Complemental strand, 7609981 - 7609836
Alignment:
Q |
1 |
ctactctttctattt--attcatgtttctttgcatctcactcaaccaattaactctcacccnnnnnnnnntcttttctaagtgttttattacgacaataa |
98 |
Q |
|
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||| |
|
|
T |
7609981 |
ctactctttctatttccattcatgtttctttgcatctcactcaaccaattaactctcacccaaaaaaaa-tcttttctaagcgttttattacgacaataa |
7609883 |
T |
 |
Q |
99 |
tgacactccacattcttgtactctatctaaacttgaggaatcaatat |
145 |
Q |
|
|
||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
T |
7609882 |
tgacactccacattcttgtactcaatctaaacttgaggaatcaatat |
7609836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University