View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0478-INSERTION-5 (Length: 158)
Name: NF0478-INSERTION-5
Description: NF0478
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0478-INSERTION-5 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 138; Significance: 2e-72; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 138; E-Value: 2e-72
Query Start/End: Original strand, 13 - 154
Target Start/End: Original strand, 6867601 - 6867742
Alignment:
| Q |
13 |
atcatcccctagaaagtcaacccttcaaaaaataatcacctagtactaataggagagtagtatgatcaacctgatgacctacatcccacaagattttgtc |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6867601 |
atcatcccctagaaagtcaacccttcaaaaaataatcatctagtactaataggagagtagtatgatcaacctgatgacctacatcccacaagattttgtc |
6867700 |
T |
|
| Q |
113 |
aataggagcattgaaaacataatggagggcaacagtgagttc |
154 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6867701 |
aataggagcattgaaaacataatggagggcaacagtgagttc |
6867742 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1217 times since January 2019
Visitors: 3439