View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0478-INSERTION-7 (Length: 137)

Name: NF0478-INSERTION-7
Description: NF0478
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0478-INSERTION-7
NF0478-INSERTION-7
[»] chr7 (1 HSPs)
chr7 (1-137)||(25802736-25802872)
[»] chr8 (2 HSPs)
chr8 (53-117)||(44346153-44346217)
chr8 (2-51)||(44346761-44346810)


Alignment Details
Target: chr7 (Bit Score: 125; Significance: 9e-65; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 125; E-Value: 9e-65
Query Start/End: Original strand, 1 - 137
Target Start/End: Complemental strand, 25802872 - 25802736
Alignment:
1 gaaagtactttccaaccatccctattctgcaaatggagttgaataactttatattactagaccgacatttcataatggttggttcaatacttatttctca 100  Q
    |||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||    
25802872 gaaagtactttccaaccatccctattctgcaaatggaggtgaataactttagattactagaccgacatttcataatggttggttcaatactcatttctca 25802773  T
101 ggctttacaaaaatcagtgaacaaaacatgaggtagg 137  Q
    |||||||||||||||||||||||||||||||||||||    
25802772 ggctttacaaaaatcagtgaacaaaacatgaggtagg 25802736  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 49; Significance: 2e-19; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 49; E-Value: 2e-19
Query Start/End: Original strand, 53 - 117
Target Start/End: Complemental strand, 44346217 - 44346153
Alignment:
53 attactagaccgacatttcataatggttggttcaatacttatttctcaggctttacaaaaatcag 117  Q
    |||||||||||| ||||||| ||||| ||||||||||||| ||||||||||||||||||||||||    
44346217 attactagaccgccatttcaaaatggctggttcaatacttctttctcaggctttacaaaaatcag 44346153  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.0000000002
Query Start/End: Original strand, 2 - 51
Target Start/End: Complemental strand, 44346810 - 44346761
Alignment:
2 aaagtactttccaaccatccctattctgcaaatggagttgaataacttta 51  Q
    ||||||||||| ||||||| | ||||||||||||||| ||||||||||||    
44346810 aaagtactttcaaaccatctcaattctgcaaatggaggtgaataacttta 44346761  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1300 times since January 2019
Visitors: 3440