View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0479_low_11 (Length: 258)
Name: NF0479_low_11
Description: NF0479
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0479_low_11 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 80; Significance: 1e-37; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 160 - 239
Target Start/End: Complemental strand, 49639633 - 49639554
Alignment:
| Q |
160 |
ggtctcttgattaatttacaggttatgttttgacccctaagtaataaatattacgttttaatcccataattccatctctg |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49639633 |
ggtctcttgattaatttacaggttatgttttgacccctaagtaataaatattacgttttaatcccataattccatctctg |
49639554 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 28 - 90
Target Start/End: Complemental strand, 49639765 - 49639703
Alignment:
| Q |
28 |
gacatcatcatcaagagaaataacgcgatttacctttttcaagttgtagcagaggctgtgatt |
90 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
49639765 |
gacatcattatcaagagaaataacgcgatttacctttttcaagttgtagcaggggctgtgatt |
49639703 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 28 - 66
Target Start/End: Original strand, 17245446 - 17245484
Alignment:
| Q |
28 |
gacatcatcatcaagagaaataacgcgatttaccttttt |
66 |
Q |
| |
|
||||||||| ||||||||||||| ||||||||||||||| |
|
|
| T |
17245446 |
gacatcatcgtcaagagaaataatgcgatttaccttttt |
17245484 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University