View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0479_low_3 (Length: 433)
Name: NF0479_low_3
Description: NF0479
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0479_low_3 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 76 - 336
Target Start/End: Original strand, 40406771 - 40407032
Alignment:
| Q |
76 |
gaggaggagcagagaggggtgacggagacggaggagacggagatggtgacgtggcctttgggagtgaaaccgaatttttcgaagaggatcatggggcgag |
175 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40406771 |
gaggaggaggagagaggggtgacggagacggaggagacggagatggtgacgtggcctttgggagtgaaaccgaatttttcgaagaggatcatggggcgag |
40406870 |
T |
|
| Q |
176 |
tgtcggaagtgatggtgagggatttgatttcggcggtggtggggaagaggaagtggaggaaggtggtgaagaggaggaggatggggatgcagggtttcga |
275 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
40406871 |
tgtcggaagtgatggtgagggatttgatttcggcggtggtgggggagaggaagtggaggaaggtggtgaagaggaggaggatggggatgtagggtttcga |
40406970 |
T |
|
| Q |
276 |
cattgtgtga-tttgggaagtgaatgttggaatctgtttgtttctgaaattggagttgggtg |
336 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40406971 |
cattgtgtgattttgggaagtgaatgttggaatctgtttgtttctgaaattggagttgggtg |
40407032 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 145 - 203
Target Start/End: Original strand, 29027523 - 29027581
Alignment:
| Q |
145 |
ccgaatttttcgaagaggatcatggggcgagtgtcggaagtgatggtgagggatttgat |
203 |
Q |
| |
|
|||||||| || |||||||||||||| || |||||||| || || |||||||||||||| |
|
|
| T |
29027523 |
ccgaatttctctaagaggatcatgggtcgggtgtcggaggttattgtgagggatttgat |
29027581 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University