View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0479_low_9 (Length: 286)
Name: NF0479_low_9
Description: NF0479
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0479_low_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 128; Significance: 3e-66; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 67 - 241
Target Start/End: Complemental strand, 18533866 - 18533685
Alignment:
| Q |
67 |
cctggaacatatgttcaatcaagaggcgagggctgcttt-------acatgttttcgaaaatttgggtttgtttgttgattgtgcgactgacggtgtttg |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
18533866 |
cctggaacatatgttcaatcaagaggcgagggctgcttctttgtgcacatgttttcgaaattttggggttgtttgttgattgtgcgactgacggtgtttg |
18533767 |
T |
 |
| Q |
160 |
gtttgcggttgttttgcattcagtttgaccacttgtgtgtgttttttgtggcctgcaactgctgtttttattttagtataat |
241 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||| ||||| |||||||||||||||||||| ||||||| |
|
|
| T |
18533766 |
gtttgcggttgttttgcattcggtttgaccacttgtgtgtgttttttatggcccgcaactgctgtttttattttggtataat |
18533685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University