View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0479_low_9 (Length: 286)

Name: NF0479_low_9
Description: NF0479
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0479_low_9
NF0479_low_9
[»] chr7 (1 HSPs)
chr7 (67-241)||(18533685-18533866)


Alignment Details
Target: chr7 (Bit Score: 128; Significance: 3e-66; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 67 - 241
Target Start/End: Complemental strand, 18533866 - 18533685
Alignment:
67 cctggaacatatgttcaatcaagaggcgagggctgcttt-------acatgttttcgaaaatttgggtttgtttgttgattgtgcgactgacggtgtttg 159  Q
    ||||||||||||||||||||||||||||||||||||||        |||||||||||||| |||||| ||||||||||||||||||||||||||||||||    
18533866 cctggaacatatgttcaatcaagaggcgagggctgcttctttgtgcacatgttttcgaaattttggggttgtttgttgattgtgcgactgacggtgtttg 18533767  T
160 gtttgcggttgttttgcattcagtttgaccacttgtgtgtgttttttgtggcctgcaactgctgtttttattttagtataat 241  Q
    ||||||||||||||||||||| ||||||||||||||||||||||||| ||||| |||||||||||||||||||| |||||||    
18533766 gtttgcggttgttttgcattcggtttgaccacttgtgtgtgttttttatggcccgcaactgctgtttttattttggtataat 18533685  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University