View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0480_high_3 (Length: 251)
Name: NF0480_high_3
Description: NF0480
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0480_high_3 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 3 - 241
Target Start/End: Original strand, 33993140 - 33993372
Alignment:
Q |
3 |
tcttttgaatgttaccaaaacttttggtaattgaaatatttagaagaaaacataagaaagaaccattgtattggagcatttttaaacatgaaaactaacc |
102 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||| ||||||||||| |
|
|
T |
33993140 |
tcttttgaatgttaccaaaacttttggtaattgaaatatttagaaaaaaacataagaa-gaaccattgtattggagcattttta-----gaaaactaacc |
33993233 |
T |
 |
Q |
103 |
tcaagagccctgttcttggcaaatgcttctggatcagcagataaaccagcagtgtcccatccataatcaccagggaattctccagttaagtatgaaggag |
202 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
33993234 |
tcaagagccctgttcttggcaaatgcttctggatcagcagataaaccagcagtgtcccatccataatcaccagggaattctccagttaagtatgaaggag |
33993333 |
T |
 |
Q |
203 |
tctgagctgaaaatggtcccaaatatttcactctctctg |
241 |
Q |
|
|
|||||||||||||||||||||||||||||||||| |||| |
|
|
T |
33993334 |
tctgagctgaaaatggtcccaaatatttcactctgtctg |
33993372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 136 - 197
Target Start/End: Complemental strand, 42602727 - 42602666
Alignment:
Q |
136 |
tcagcagataaaccagcagtgtcccatccataatcaccagggaattctccagttaagtatga |
197 |
Q |
|
|
||||| ||||| ||||| ||||||||||||||||||||||| ||||| ||||| |||||||| |
|
|
T |
42602727 |
tcagctgataatccagctgtgtcccatccataatcaccaggaaattcaccagtcaagtatga |
42602666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 35; Significance: 0.00000000009; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 114 - 188
Target Start/End: Complemental strand, 3575916 - 3575842
Alignment:
Q |
114 |
gttcttggcaaatgcttctggatcagcagataaaccagcagtgtcccatccataatcaccagggaattctccagt |
188 |
Q |
|
|
|||||||||||||| ||||| |||||||| | |||||||||||||| ||||| |||||||| ||||| ||||| |
|
|
T |
3575916 |
gttcttggcaaatgtctctgggtcagcagaaagcccagcagtgtcccaaccatagtcaccaggaaattcaccagt |
3575842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 121 - 194
Target Start/End: Complemental strand, 13275858 - 13275785
Alignment:
Q |
121 |
gcaaatgcttctggatcagcagataaaccagcagtgtcccatccataatcaccagggaattctccagttaagta |
194 |
Q |
|
|
||||||| |||||||||||||| | |||||||| | ||| |||||||||||||||||||| ||||| ||||| |
|
|
T |
13275858 |
gcaaatgtctctggatcagcagaaagtccagcagtattccaaccataatcaccagggaattcaccagtcaagta |
13275785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 114 - 182
Target Start/End: Complemental strand, 3569585 - 3569517
Alignment:
Q |
114 |
gttcttggcaaatgcttctggatcagcagataaaccagcagtgtcccatccataatcaccagggaattc |
182 |
Q |
|
|
|||||||||||||| ||||| |||||||| | |||||||||||||| || || |||||||||||||| |
|
|
T |
3569585 |
gttcttggcaaatgtctctgggtcagcagaaagtccagcagtgtcccaaccgtagtcaccagggaattc |
3569517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 114 - 194
Target Start/End: Complemental strand, 38356952 - 38356872
Alignment:
Q |
114 |
gttcttggcaaatgcttctggatcagcagataaaccagcagtgtcccatccataatcaccagggaattctccagttaagta |
194 |
Q |
|
|
||||||||| |||| ||||| |||||||| | ||||||||||||||||| || ||||| ||||| |||||||| ||||| |
|
|
T |
38356952 |
gttcttggcgaatgtctctgggtcagcagaaagtccagcagtgtcccatccgtagtcacctgggaactctccagtcaagta |
38356872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University