View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0480_high_3 (Length: 251)

Name: NF0480_high_3
Description: NF0480
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0480_high_3
NF0480_high_3
[»] chr2 (1 HSPs)
chr2 (3-241)||(33993140-33993372)
[»] chr5 (1 HSPs)
chr5 (136-197)||(42602666-42602727)
[»] chr6 (3 HSPs)
chr6 (114-188)||(3575842-3575916)
chr6 (121-194)||(13275785-13275858)
chr6 (114-182)||(3569517-3569585)
[»] chr4 (1 HSPs)
chr4 (114-194)||(38356872-38356952)


Alignment Details
Target: chr2 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 3 - 241
Target Start/End: Original strand, 33993140 - 33993372
Alignment:
3 tcttttgaatgttaccaaaacttttggtaattgaaatatttagaagaaaacataagaaagaaccattgtattggagcatttttaaacatgaaaactaacc 102  Q
    ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||     |||||||||||    
33993140 tcttttgaatgttaccaaaacttttggtaattgaaatatttagaaaaaaacataagaa-gaaccattgtattggagcattttta-----gaaaactaacc 33993233  T
103 tcaagagccctgttcttggcaaatgcttctggatcagcagataaaccagcagtgtcccatccataatcaccagggaattctccagttaagtatgaaggag 202  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33993234 tcaagagccctgttcttggcaaatgcttctggatcagcagataaaccagcagtgtcccatccataatcaccagggaattctccagttaagtatgaaggag 33993333  T
203 tctgagctgaaaatggtcccaaatatttcactctctctg 241  Q
    |||||||||||||||||||||||||||||||||| ||||    
33993334 tctgagctgaaaatggtcccaaatatttcactctgtctg 33993372  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 136 - 197
Target Start/End: Complemental strand, 42602727 - 42602666
Alignment:
136 tcagcagataaaccagcagtgtcccatccataatcaccagggaattctccagttaagtatga 197  Q
    ||||| ||||| ||||| ||||||||||||||||||||||| ||||| ||||| ||||||||    
42602727 tcagctgataatccagctgtgtcccatccataatcaccaggaaattcaccagtcaagtatga 42602666  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 35; Significance: 0.00000000009; HSPs: 3)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 114 - 188
Target Start/End: Complemental strand, 3575916 - 3575842
Alignment:
114 gttcttggcaaatgcttctggatcagcagataaaccagcagtgtcccatccataatcaccagggaattctccagt 188  Q
    ||||||||||||||  ||||| |||||||| |  |||||||||||||| ||||| |||||||| ||||| |||||    
3575916 gttcttggcaaatgtctctgggtcagcagaaagcccagcagtgtcccaaccatagtcaccaggaaattcaccagt 3575842  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 121 - 194
Target Start/End: Complemental strand, 13275858 - 13275785
Alignment:
121 gcaaatgcttctggatcagcagataaaccagcagtgtcccatccataatcaccagggaattctccagttaagta 194  Q
    |||||||  |||||||||||||| |  |||||||| | ||| |||||||||||||||||||| ||||| |||||    
13275858 gcaaatgtctctggatcagcagaaagtccagcagtattccaaccataatcaccagggaattcaccagtcaagta 13275785  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 114 - 182
Target Start/End: Complemental strand, 3569585 - 3569517
Alignment:
114 gttcttggcaaatgcttctggatcagcagataaaccagcagtgtcccatccataatcaccagggaattc 182  Q
    ||||||||||||||  ||||| |||||||| |  |||||||||||||| || || ||||||||||||||    
3569585 gttcttggcaaatgtctctgggtcagcagaaagtccagcagtgtcccaaccgtagtcaccagggaattc 3569517  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 114 - 194
Target Start/End: Complemental strand, 38356952 - 38356872
Alignment:
114 gttcttggcaaatgcttctggatcagcagataaaccagcagtgtcccatccataatcaccagggaattctccagttaagta 194  Q
    ||||||||| ||||  ||||| |||||||| |  ||||||||||||||||| || ||||| ||||| |||||||| |||||    
38356952 gttcttggcgaatgtctctgggtcagcagaaagtccagcagtgtcccatccgtagtcacctgggaactctccagtcaagta 38356872  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 117 times since January 2019
Visitors: 3464